SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


secondary manganese (II) efflux pump
31.63 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
Mn(II) export
manganese (II) efflux pump

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    686,962 687,834

    Phenotypes of a mutant

  • a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS] double mutant is extremely senitive to Mn2+ intoxication [pubmed|31685536]
  • The protein

    Catalyzed reaction/ biological activity

  • efflux of Mn(II) [Pubmed|27748968]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
  • Paralogous protein(s)

  • [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|YdbO], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|MneP]
  • Structure

  • [PDB|5VRF] (from Shewanella oneidensis, 28% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|27748968], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: transcription activation, [Pubmed|27748968], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • view in new tab

    Biological materials


  • MGNA-A914 (yeaB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC, downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
  • BKK06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC, downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
  • References

  • 27748968,29507252,31685536