SubtiBank SubtiBank
yeaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yeaB

secondary manganese (II) efflux pump
locus
BSU06320
pI
5.63
mw
31.63 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
Mn(II) export
product
manganese (II) efflux pump
essential
no
synonyms
ydxT,yeaB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.13|Metal ion exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    686,962 687,834

    The protein

    Catalyzed reaction/ biological activity

  • efflux of Mn(II) [Pubmed|27748968]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
  • Paralogous protein(s)

  • [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|YdbO], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|YdfM]
  • Structure

  • [PDB|5VRF] (from Shewanella oneidensis, 28% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|yeaB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|27748968], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: transcription activation, [Pubmed|27748968], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A914 (yeaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/914 NBRP B. subtilis, Japan]
  • BKE06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|yeaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC, downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
  • BKK06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|yeaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC, downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
  • References

  • 27748968,29507252