SubtiBank SubtiBank
copA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

copA

copper-transporting ATPase, resistance to copper
locus
BSU33500
pI
5.48
mw
85.83 kDa
protein length
803 aa Sequence Blast
gene length
2409 bp Sequence Blast
function
copper export, detoxification
product
copper transporting ATPase
essential
no
synonyms
yvgX

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,441,121 → 3,443,529

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + Cu1+(In) = ADP + phosphate + Cu1+(Out) (according to Swiss-Prot)
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|PfeT], [protein|5BC6B02770E74FF6D453742832574A87BB2369B8|CadA]
  • [SW|Domains]

  • two N-terminal soluble domains, CopAa and CopAb, connected by a short linker [pubmed|29146226]
  • Structure

  • [PDB|4BBJ] (the protein from ''Legionella pneumophila'', 45% identity, 79% similarity) [Pubmed|24317491]
  • [PDB|2RML] ( N-terminal soluble domain) [pubmed|18215122]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
    description
    [Pubmed|12779235]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|18048925], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A490 (yvgX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/490 NBRP B. subtilis, Japan]
  • BKE33500 (Δ[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATACTCACTCCTTTAT, downstream forward: _UP4_TGAAAAACCGGCTATATGCC
  • BKK33500 (Δ[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATACTCACTCCTTTAT, downstream forward: _UP4_TGAAAAACCGGCTATATGCC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 19824702,23046649
  • Original publications

  • 19751213,11922674,12590580,14663075,12779235,12644235,18048925,14514665,14711369,19378562,15212800,20233928,24317491,22531974,22077885,28078344,29146226,30342352,18215122