SubtiBank SubtiBank
ymfK/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymfK/1

part of the ymfK pseudogene
locus
BSU_16890
pI
0.00
mw
0.00 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
unknwon
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    1,760,851 1,761,303

    The protein

    [SW|Domains]

  • [SW|ACT domain] (aa 14 ... 89) (according to the Interpro database)
  • Expression and Regulation

    Operons

    genes
    [gene|725094DC9353EBB5FD603AB389607D8C13DF5F51|ymfK/1]-[gene|9394EA0675DFFCB5F0ECD494C104A66CE13A8EF6|ymfK/2]-[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE16890 ([gene|725094DC9353EBB5FD603AB389607D8C13DF5F51|ymfK/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGATATACCCCCTTCA, downstream forward: _UP4_GTAGCCTCTAGTGTGTGCGA
  • BKK16890 ([gene|725094DC9353EBB5FD603AB389607D8C13DF5F51|ymfK/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGATATACCCCCTTCA, downstream forward: _UP4_GTAGCCTCTAGTGTGTGCGA