SubtiBank SubtiBank
yvkC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvkC

similar to pyruvate water dikinase
locus
BSU_35190
pI
4.62
mw
94.25 kDa
protein length
831 aa Sequence Blast
gene length
2496 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,615,793 3,618,288

    The protein

    Protein family

  • [SW|PEP-utilizing enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|Pps]
  • Structure

  • [PDB|5FBU](rifampin phosphotransferase from Listeria monocytogenes, 34% identity) [pubmed|27103605]
  • Expression and Regulation

    Operons

    genes
    [gene|7235F9D0048961BBD93FA6A4322018029A607435|yvkC]-[gene|672EAC84789910ADB2C2A449910BEECA39A9A2B1|yvkB]-[gene|F4028F82CCF1A0335D1ABF823645A36D9072F17F|yvkA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A341 (yvkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/341 NBRP B. subtilis, Japan]
  • BKE35190 ([gene|7235F9D0048961BBD93FA6A4322018029A607435|yvkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAAACCCCTCTTT, downstream forward: _UP4_TGATGCGTCCCCCTCTTTCT
  • BKK35190 ([gene|7235F9D0048961BBD93FA6A4322018029A607435|yvkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAAACCCCTCTTT, downstream forward: _UP4_TGATGCGTCCCCCTCTTTCT
  • References

    Research papers

  • 27103605