SubtiBank SubtiBank
folD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

folD

methylenetetrahydrofolate dehydrogenase (NADP)
locus
BSU_24310
pI
5.60
mw
30.53 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
formylation of Met-tRNA(fMet)
product
methylenetetrahydrofolate dehydrogenase (NADP)
essential
no
ec
1.5.1.5
synonyms
yqiA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,528,404 2,529,255

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + NADP+ --> 5,10-methenyltetrahydrofolate + NADPH (according to UniProt)
  • 5,10-methenyltetrahydrofolate + H2O --> (6S)-10-formyltetrahydrofolate + H+ (according to UniProt)
  • Protein family

  • tetrahydrofolate dehydrogenase/cyclohydrolase family (single member, according to UniProt)
  • Structure

  • [PDB|1B0A] (from ''E. coli'', 52% identity) [Pubmed|10386884]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]-[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]
    description
    [Pubmed|2536750,11591660]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750,11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|2536750,11591660]
  • view in new tab

    Biological materials

    Mutant

  • BKE24310 ([gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • BKK24310 ([gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • References

  • 11591660,19171795,11591660,19171795,10386884,27983482,28189581