SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


methylenetetrahydrofolate dehydrogenase (NADP)
30.53 kDa
protein length
283 aa Sequence Blast
gene length
849 bp Sequence Blast
formylation of Met-tRNA(fMet)
methylenetetrahydrofolate dehydrogenase (NADP)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    2,528,404 → 2,529,255

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • 5,10-methylenetetrahydrofolate + NADP+ = 5,10-methenyltetrahydrofolate + NADPH (according to Swiss-Prot)
  • Protein family

  • tetrahydrofolate dehydrogenase/cyclohydrolase family (according to Swiss-Prot)
  • Structure

  • [PDB|1B0A] (from ''E. coli'', 52% identity) [Pubmed|10386884]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750,11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|2536750,11591660]
  • view in new tab

    Biological materials


  • BKE24310 (Δ[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • BKK24310 (Δ[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • References

  • 11591660,19171795,11591660,19171795,10386884,27983482,28189581