SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Ferri-bacillibactin esterase
35.34 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
iron acquisition
ferri-bacillibactin esterase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Acquisition of iron / Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    3,292,490 3,293,359

    The protein

    Catalyzed reaction/ biological activity

  • catalyses ferri-bacillibactin hydrolysis leading to cytosolic iron release [pubmed|28283524]
  • Protein family

  • Esterase D family (single member, according to UniProt)
  • Structure

  • [PDB|2QM0] (from B. cereus, 46% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • MGNA-A650 (yuiI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32010 ([gene|71F490B2C3199734620724B51F8E3D7977C2D8D8|besA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTACGACATTCCTC, downstream forward: _UP4_TGAGACATACTCAGCCTTGC
  • BKK32010 ([gene|71F490B2C3199734620724B51F8E3D7977C2D8D8|besA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTACGACATTCCTC, downstream forward: _UP4_TGAGACATACTCAGCCTTGC
  • References

  • 16889643,12354229,19673474,20817675,28283524