SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.47 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,046,980 2,047,411

    The protein


  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|3104598], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|3104598]
  • view in new tab

    Biological materials


  • MGNA-A304 (yoaW::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A936 ( ''yoaW''::''cat''), [Pubmed|15101989], available at [ BGSC]
  • BKE18780 ([gene|71F01F20CF4E6E816BE2567B4287F93A99C9FF7D|yoaW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAGTTCCTCCCGATA, downstream forward: _UP4_TAATAAAAAAGTATCTGGAT
  • BKK18780 ([gene|71F01F20CF4E6E816BE2567B4287F93A99C9FF7D|yoaW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAGTTCCTCCCGATA, downstream forward: _UP4_TAATAAAAAAGTATCTGGAT
  • References

  • 15101989,18957862,3104598,20709850,30732606