SubtiBank SubtiBank
yoaW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaW

unknown
locus
BSU_18780
pI
5.16
mw
16.47 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,046,980 2,047,411

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|71F01F20CF4E6E816BE2567B4287F93A99C9FF7D|yoaW]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|3104598], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|3104598]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A304 (yoaW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/304 NBRP B. subtilis, Japan]
  • 1A936 ( ''yoaW''::''cat''), [Pubmed|15101989], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A936&Search=1A936 BGSC]
  • BKE18780 ([gene|71F01F20CF4E6E816BE2567B4287F93A99C9FF7D|yoaW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAGTTCCTCCCGATA, downstream forward: _UP4_TAATAAAAAAGTATCTGGAT
  • BKK18780 ([gene|71F01F20CF4E6E816BE2567B4287F93A99C9FF7D|yoaW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAGTTCCTCCCGATA, downstream forward: _UP4_TAATAAAAAAGTATCTGGAT
  • References

  • 15101989,18957862,3104598,20709850,30732606