SubtiBank SubtiBank
citH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

citH

sporulation-specific secondary transporter of divalent metal ions/citrate complexes
locus
BSU_39060
pI
9.28
mw
45.37 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
citrate uptake
product
secondary transporter of divalent metal ions/citrate complexes
essential
no
synonyms
yxiQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,010,404 4,011,684

    The protein

    Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C0DED68802EF78D2BC16507234AAC3B60D236E68|CitM]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|71A73C825981E74842FC28D1B05CF85E9F3F5A56|citH]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|22383849], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B723 (yxiQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1722 NBRP B. subtilis, Japan]
  • BKE39060 ([gene|71A73C825981E74842FC28D1B05CF85E9F3F5A56|citH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATGACCTCCCCTAT, downstream forward: _UP4_TAAATGTATGAGCTTGATCG
  • BKK39060 ([gene|71A73C825981E74842FC28D1B05CF85E9F3F5A56|citH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATGACCTCCCCTAT, downstream forward: _UP4_TAAATGTATGAGCTTGATCG
  • References

  • 8892821,22383849,11053381