SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


regulator of carbon partitioning between central metabolism and peptidoglycan biosynthesis, control of [SW|cell shape], required for correct localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
34.53 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
regulation of carbon partitioning between central metabolism and peptidoglycan biosynthesis, localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
activator of [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    3,570,546 3,571,499

    Phenotypes of a mutant

  • unable to grow with gluconeogenic substrates as single carbon source, this can be suppressed by mutations in [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR], [gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf], [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI], upon overexpression of [gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS] or by a point mutation in [protein|70412A747D1ED3E885126945DF02503667C13E5B|PgcA] (G47S) that results in increased phosphoglucosamine mutase activity [Pubmed|31589605,30478337,30248093,16272399]
  • filamentous or L-shape-like aberrant morphologies (suppressed by Mg2+) [Pubmed|16272399], this is supressed by overexpression of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] or by deletion of [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], or [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI] [Pubmed|30478337,21320184]
  • a [gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA] [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] double mutant is not viable, this can be suppressed by overexpression of [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|GlmM] [pubmed|31589605]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity to facilitate the diversion of carbon from fructose-6-phosphate to peptidoglycan synthesis [pubmed|32994436,30248093]
  • interacts with [protein|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|YvcJ] to facilitate genetic transformation [pubmed|32994436]
  • Protein family

  • gluconeogenesis factor family (single member, according to UniProt)
  • [SW|Domains]

  • phosphorylated on Thr-304 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|25012659]
  • Effectors of protein activity

  • binds UDP-GlcNAc [pubmed|28646159], this prevents the interaction with [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] and stimulates interaction with [protein|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|YvcJ] [pubmed|32994436,30248093]
  • Structure

  • [PDB|2O2Z] (the protein from ''B. halodurans'', 63% identity, 86% similarity)
  • [SW|Localization]

  • localized as a helical-like pattern [Pubmed|25012659,21320184]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-B640 (yvcK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • BKK34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • Expression vectors

  • pGP736 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Boris Görke]'s lab
  • labs

  • [SW|Anne Galinier], University of Marseille, France
  • References


  • 21371139
  • Original publications

  • 9237995,16272399,21320184,25012659,25047842,27806131,28646159,30248093,30478337,31589605,32994436