SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


33.29 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
resistance to beta-lactam antibiotics

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,048,533 2,049,453

    The protein

    Catalyzed reaction/ biological activity

  • β-lactam + H2O --> substituted β-amino acid (according to UniProt)
  • Protein family

  • [SW|beta-lactamase family] (according to UniProt)
  • class-A beta-lactamase family (single member, according to UniProt)
  • Structure

  • [PDB|6NI1]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
  • BKK18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
  • References

  • 18957862,30637927