SubtiBank SubtiBank
penP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

penP

beta-lactamase
locus
BSU_18800
pI
9.21
mw
33.29 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
resistance to beta-lactam antibiotics
product
beta-lactamase
essential
no
ec
3.5.2.6
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,048,533 2,049,453

    The protein

    Catalyzed reaction/ biological activity

  • β-lactam + H2O --> substituted β-amino acid (according to UniProt)
  • Protein family

  • [SW|beta-lactamase family] (according to UniProt)
  • class-A beta-lactamase family (single member, according to UniProt)
  • Structure

  • [PDB|6NI1]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
  • BKK18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
  • References

  • 18957862,30637927