SubtiBank SubtiBank
ydaK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaK

general stress protein, may act as c-di-GMP receptor, required for extracellular polysaccharide synthesis by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|YdaL]-[protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM]-[protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]
locus
BSU_04280
pI
6.70
mw
32.53 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
unknown
product
general stress protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.2|Targets of c-di-GMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    480,013 480,864

    The protein

    [SW|Domains]

  • four transmembrane helices at the N-terminus, they are essential for activation of EPS formation by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|YdaL], [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM], and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN] [pubmed|28536559]
  • contains a C-terminal degenerated [SW|GGDEF domain] [Pubmed|23893111]
  • [SW|GGDEF domain] (aa 162-283) (according to UniProt)
  • [SW|Cofactors]

  • binds c-di-GPM at high concentration (K(D) for c-di-GMP: 1.1 myM) [Pubmed|23893111]
  • [SW|Localization]

  • cell membrane, forms clusters at the cell poles and septa (with [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM] and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]) [Pubmed|27897378]
  • Expression and Regulation

    Operons

    genes
    [gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22383849], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C074 (ydaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2072 NBRP B. subtilis, Japan]
  • GP1592 (kan) available in [SW|Jörg Stülke]'s lab
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04280 ([gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT, downstream forward: _UP4_ATGAATGAACTATAAAGGAA
  • BKK04280 ([gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT, downstream forward: _UP4_ATGAATGAACTATAAAGGAA
  • References

    Reviews

  • 28296273
  • Original publications

  • 22383849,22821967,23893111,27897378,28536559