SubtiBank SubtiBank
yqeT [2019-02-19 19:32:57]

yqeT [2019-02-19 19:32:57]

similar to ribosomal protein L11 methyltransferase
locus
BSU25450
pI
4.60
mw
34.44 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,623,825 2,624,760

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3GRZ] (from Lactococcus delbrckii, C-terminal domain, corresponds to aa 116 ... 311, 44% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C498 (yqeT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2496 NBRP B. subtilis, Japan]
  • CS215 (''[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jrg Stlke]'s labs) [Pubmed|27197833]
  • BKE25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • BKK25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • References

  • 10383760,9023197,7592421,27197833