SubtiBank SubtiBank
yqeT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeT

similar to ribosomal protein L11 methyltransferase
locus
BSU_25450
pI
4.60
mw
34.44 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,623,825 2,624,760

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3GRZ] (from Lactococcus delbrckii, C-terminal domain, corresponds to aa 116 ... 311, 44% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C498 (yqeT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2496 NBRP B. subtilis, Japan]
  • CS215 (''[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • BKK25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • References

  • 10383760,9023197,7592421,27197833