SubtiBank SubtiBank


similar to ribosomal protein L11 methyltransferase
34.44 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    2,623,825 2,624,760

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3GRZ] (from Lactococcus delbrckii, C-terminal domain, corresponds to aa 116 ... 311, 44% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • MGNA-C498 (yqeT::erm), available at the [ NBRP B. subtilis, Japan]
  • CS215 (''[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • BKK25450 ([gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTACCAACTCCTCAT, downstream forward: _UP4_TAACAGTTAGTAGGTGTCAC
  • References

  • 10383760,9023197,7592421,27197833