SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


subunit of chromate exporter (with [protein|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|YwrB])
19.08 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
chromate detoxification
chromate exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,722,005 3,722,541

    The protein

    Protein family

  • chromate ion transporter (CHR) (TC 2.A.51) family (with [protein|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|YwrB], according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|22900751]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23989926], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS]: repression, [Pubmed|23989926], in [regulon|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS regulon]
  • view in new tab

    Biological materials


  • MGNA-A569 (ywrA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36130 ([gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCATAAATAAATAGATCG, downstream forward: _UP4_TAGAAAAAAGCACCTGGACA
  • BKK36130 ([gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCATAAATAAATAGATCG, downstream forward: _UP4_TAGAAAAAAGCACCTGGACA
  • References

  • 19581367,22383849,22900751,23989926