SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


SMC-like protein, involved in DNA double-strand break repair and competence
110.96 kDa
protein length
963 aa Sequence Blast
gene length
2892 bp Sequence Blast
DNA double-strand break repair and competence
SMC-like protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    1,066,077 1,068,968

    The protein


  • Membrane-proximal (Spotty) [Pubmed|16479537]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • MGNA-A663 (yhaN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09920 ([gene|709C4D0AE9C78C9A367F37B9C3B37D2516850D7C|sbcE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAATTCGCAAAGCTGTCA, downstream forward: _UP4_TAAAAGAGGTTCTATAGCTG
  • BKK09920 ([gene|709C4D0AE9C78C9A367F37B9C3B37D2516850D7C|sbcE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAATTCGCAAAGCTGTCA, downstream forward: _UP4_TAAAAGAGGTTCTATAGCTG
  • References

  • 16267290,16479537,19903937,19906728