SubtiBank SubtiBank
ynzL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ynzL

unknown
locus
BSU_18019
pI
9.70
mw
5.20 kDa
protein length
gene length
126 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,930,074 1,930,199

    Biological materials

    Mutant

  • BKE18019 ([gene|7089FB028CFECEB10F9BBCEE97106231043A6F4B|ynzL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18019 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTCTCACCTCCGCAT, downstream forward: _UP4_TAACCTTTAATTTGTATTCA
  • BKK18019 ([gene|7089FB028CFECEB10F9BBCEE97106231043A6F4B|ynzL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18019 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTCTCACCTCCGCAT, downstream forward: _UP4_TAACCTTTAATTTGTATTCA