SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


5.20 kDa
protein length
gene length
126 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,930,074 1,930,199

    Biological materials


  • BKE18019 ([gene|7089FB028CFECEB10F9BBCEE97106231043A6F4B|ynzL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTCTCACCTCCGCAT, downstream forward: _UP4_TAACCTTTAATTTGTATTCA
  • BKK18019 ([gene|7089FB028CFECEB10F9BBCEE97106231043A6F4B|ynzL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTCTCACCTCCGCAT, downstream forward: _UP4_TAACCTTTAATTTGTATTCA