SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional activator of the [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|search|acoL ]operon
66.98 kDa
protein length
605 aa Sequence Blast
gene length
1818 bp Sequence Blast
regulation of acetoin utilization
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of acetoin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    883,758 885,575

    The protein

    Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • [SW|Domains]

  • Sigma-54 factor interaction domain (aa 295-520) (according to UniProt)
  • Structure

  • [PDB|5EXX] (from Pseudomonas aeruginosa, C-terminal doamin, corresponds to aa 292 ... 598, 43% identity) [pubmed|26712005]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-C352 (acoR::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A912 ( ''acoR''::''kan''), [Pubmed|16585774], available at [ BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC, downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
  • BKK08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC, downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 11274109,10368162,22900538,12850135,21906631,26712005