SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


alpha-phosphoglucomutase, required for UDP-glucose synthesis, inhibits [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] ring assembly (indirect effect due to a defect in UDP-glucose synthesis), possesses a secondary phosphoglucosamine mutase activity
62.73 kDa
protein length
581 aa Sequence Blast
gene length
1746 bp Sequence Blast
interconversion of glucose 6-phosphate and alpha-glucose 1-phosphate

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,006,774 1,008,519

    Phenotypes of a mutant

  • cells are bent and distended due to the lack of glucolipids [Pubmed|27684739]
  • the inactivation of ''[gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]'' suppresses the poor and filamentous growth of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant [Pubmed|24097947]
  • inactivation of ''[gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller and wider mother cells with small forespores [Pubmed|26735940]
  • resistant to phage SPO1 [pubmed|30811056]
  • a [gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA] [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] double mutant is not viable, this can be suppressed by overexpression of [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|GlmM] [pubmed|31589605]
  • The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate --> α-D-glucose 6-phosphate (according to UniProt)
  • D-glucosamine 6-phosphate --> α-D-glucosamine 1-phosphate (secondary activity, this activity is increased by a G47S mutation) [pubmed|31589605]
  • Protein family

  • phosphohexose mutase family (with [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|GlmM], [pubmed|15238632])
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|2Z0F] (from Thermus thermophilus, 27% identity)
  • Additional information

  • PgcA inhibits [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] ring assembly (indirect effect due to a defect in UDP-glucose synthesis)[Pubmed|17662947]
  • a PgcA (G47S) variant suppresses the growth defect of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant on gluconeogenic carbon sources in the absence of glucose due to the increased phosphoglucosamine mutase activity [pubmed|31589605]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B476 (yhxB::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1743: BSB1 ''pgcA::aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE09310 ([gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
  • BKK09310 ([gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
  • References


  • 20735481
  • Original publications

  • 15175311,17726680,16493705,15640167,17662947,22396664,24097947,26735940,27684739,15238632,30811056,31589605