SubtiBank SubtiBank
yolA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yolA

unknown
locus
BSU_21540
pI
9.75
mw
17.09 kDa
protein length
155 aa Sequence Blast
gene length
468 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,272,896 2,273,363

    The protein

    Structure

  • [PDB|2LR4]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]-[gene|1F99778502096A7EA726EB767E1BA5F0D1F770AB|yolB]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21540 ([gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTAAATCCTCCTTG, downstream forward: _UP4_GATTTTGAAAGAGAGTGAAC
  • BKK21540 ([gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTAAATCCTCCTTG, downstream forward: _UP4_GATTTTGAAAGAGAGTGAAC
  • References

  • 18957862,20525796,20817675