SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


9.78 kDa
protein length
gene length
282 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,537,689 2,537,970

    The protein


  • membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab

    Biological materials


  • BKE24440 ([gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACTCTCCCAACCTC, downstream forward: _UP4_TAAAGAGAGGCTTGTCATAA
  • BKK24440 ([gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACTCTCCCAACCTC, downstream forward: _UP4_TAAAGAGAGGCTTGTCATAA
  • References

  • 1766372