SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


porphobilinogen synthase
36.05 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
heme biosynthesis
porphobilinogen synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,874,202 2,875,176

    The protein

    Catalyzed reaction/ biological activity

  • 2 5-aminolevulinate = porphobilinogen + 2 H2O (according to Swiss-Prot)
  • Protein family

  • ALADH family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-217 [Pubmed|22517742]
  • [SW|Cofactors]

  • zinc
  • Structure

  • [PDB|1W5Q] (from ''Pseudomonas aeruginosa'', 48% identity) [Pubmed|15644204]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials


  • BKE28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT, downstream forward: _UP4_TAATTTTATTCAGTTGACAG
  • BKK28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT, downstream forward: _UP4_TAATTTTATTCAGTTGACAG
  • References


  • 28123057
  • Original Publications

  • 10217486,11532148,1672867,4214010,804803,12926268,20823524,22517742,15644204