SubtiBank SubtiBank
thyA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thyA

thymidylate synthase A
locus
BSU_17680
pI
5.50
mw
32.65 kDa
protein length
279 aa Sequence Blast
gene length
840 bp Sequence Blast
function
biosynthesis of thymidine nucleotides
product
thymidylate synthase A
essential
no
ec
2.1.1.45
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,902,219 1,903,058

    The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + dUMP --> 7,8-dihydrofolate + dTMP (according to UniProt)
  • Protein family

  • thymidylate synthase family (with [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|ThyB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|ThyB]
  • Structure

  • [PDB|1B02] [pubmed|10091656]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC, downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
  • BKK17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC, downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
  • References

    Reviews

  • 7574499
  • Original publications

  • 418407,11267663,28700593,10091656,7704257,9648749,111614,29150519