SubtiBank SubtiBank
ykvZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykvZ

similar to transcriptional regulator ([SW|LacI family])
locus
BSU_13870
pI
7.30
mw
36.04 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    1,455,064 1,456,029

    The protein

    Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-56) (according to UniProt)
  • Structure

  • [PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]-[gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]-[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B331 (ykvZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1330 NBRP B. subtilis, Japan]
  • BKE13870 ([gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTCCCTTCTTTCTA, downstream forward: _UP4_TAGTGAATGCATTGAAAAAA
  • BKK13870 ([gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTCCCTTCTTTCTA, downstream forward: _UP4_TAGTGAATGCATTGAAAAAA