SubtiBank SubtiBank
yqcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcD

similar to phage-related protein
locus
BSU25940
pI
4.39
mw
12.30 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,667,045 2,667,380

    The protein

    Paralogous protein(s)

  • [protein|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|XkdW]
  • Structure

  • [PDB|2HG7] ([protein|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|XkdW], 67% identity)
  • Biological materials

    Mutant

  • BKE25940 ([gene|6FC5C37F7C823518FD864EECD04D6F762A4817E4|yqcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTACCTCCTAAAATC, downstream forward: _UP4_TCATGAATTATTGGGTGCTG
  • BKK25940 ([gene|6FC5C37F7C823518FD864EECD04D6F762A4817E4|yqcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTACCTCCTAAAATC, downstream forward: _UP4_TCATGAATTATTGGGTGCTG