SubtiBank SubtiBank
yqcD

yqcD

similar to phage-related protein
locus
BSU_25940
pI
4.39
mw
12.30 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,667,045 2,667,380

    The protein

    Paralogous protein(s)

  • [protein|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|XkdW]
  • Structure

  • [PDB|2HG7] ([protein|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|XkdW], 67% identity)
  • Biological materials

    Mutant

  • BKE25940 ([gene|6FC5C37F7C823518FD864EECD04D6F762A4817E4|yqcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTACCTCCTAAAATC, downstream forward: _UP4_TCATGAATTATTGGGTGCTG
  • BKK25940 ([gene|6FC5C37F7C823518FD864EECD04D6F762A4817E4|yqcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTACCTCCTAAAATC, downstream forward: _UP4_TCATGAATTATTGGGTGCTG