SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcription elongation factor, resolves stalled [SW|RNA polymerase] at promoter or promoter-proximal regions
17.00 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
transcription elongation
transcription elongation factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Transcription elongation/ termination]
  • Gene

    2,791,494 2,791,967

    Phenotypes of a mutant

  • [SW|RNA polymerase] accumulates in promoter-proximal regions of many genes [Pubmed|21515770]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • resolves stalled [SW|RNA polymerase] at promoter or promoter-proximal regions
  • required for repair of DNA lesions during growth [pubmed|32041798]
  • promotes error-prone DNA repair during stress to promote genetic diversity [pubmed|32041798]
  • Protein family

  • GreA/GreB family (single member, according to UniProt)
  • Structure

  • [PDB|1GRJ] (from ''E. coli'', 43% identity) [Pubmed|7854424]
  • [SW|Localization]

  • uniformly distributed throughout the nucleoid [Pubmed|16707701,21515770]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BP351 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''cat'') available in [SW|Fabian Commichau]'s lab
  • GP2612 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE27320 (''[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab)
  • BKE27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • BKK27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • Expression vectors

  • C-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP382]: pGP2547, available in [SW|Jörg Stülke]'s lab [pubmed|28189581]
  • lacZ fusion

  • pGP2546 in ([SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GP2537 (kan), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP2527 (in [SW|pBP43]), expression of '' greA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2525 (in [SW|pBP43]), expression of '' greA-FLAG''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • References


  • 16815708,15720542,15294154,24763425
  • Original Publications

  • 16707701,21266474,21515770,23543716,7854424,17917675,14633991,28242762,28700593,28189581,32041798