SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcription elongation factor, resolves stalled [SW|RNA polymerase] at promoter or promoter-proximal regions
17.00 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
transcription elongation
transcription elongation factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Transcription elongation/ termination]
  • Gene

    2,791,494 2,791,967

    Phenotypes of a mutant

  • [SW|RNA polymerase] accumulates in promoter-proximal regions of many genes [Pubmed|21515770]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • resolves stalled [SW|RNA polymerase] at promoter or promoter-proximal regions
  • required for repair of DNA lesions during growth [pubmed|32041798]
  • promotes error-prone DNA repair during stress to promote genetic diversity [pubmed|32041798]
  • Protein family

  • GreA/GreB family (single member, according to UniProt)
  • Structure

  • [PDB|1GRJ] (from ''E. coli'', 43% identity) [Pubmed|7854424]
  • [SW|Localization]

  • uniformly distributed throughout the nucleoid [Pubmed|16707701,21515770]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BP351 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''cat'') available in [SW|Fabian Commichau]'s lab
  • GP2612 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE27320 (''[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab)
  • BKE27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • BKK27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • Expression vectors

  • C-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP382]: pGP2547, available in [SW|Jörg Stülke]'s lab [pubmed|28189581]
  • lacZ fusion

  • pGP2546 in ([SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GP2537 (kan), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP2527 (in [SW|pBP43]), expression of '' greA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2525 (in [SW|pBP43]), expression of '' greA-FLAG''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • References


  • 16815708,15720542,15294154,24763425
  • Original Publications

  • 16707701,21266474,21515770,23543716,7854424,17917675,14633991,28242762,28700593,28189581,32041798