SubtiBank SubtiBank
greA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

greA

transcription elongation factor, resolves stalled [SW|RNA polymerase] at promoter or promoter-proximal regions,
locus
BSU_27320
pI
4.00
mw
17.00 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
transcription elongation
product
transcription elongation factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • Gene

    Coordinates
    2,791,494 2,791,967

    Phenotypes of a mutant

  • [SW|RNA polymerase] accumulates in promoter-proximal regions of many genes [Pubmed|21515770]
  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • GreA/GreB family (single member, according to UniProt)
  • Structure

  • [PDB|1GRJ] (from ''E. coli'', 43% identity) [Pubmed|7854424]
  • [SW|Localization]

  • uniformly distributed throughout the nucleoid [Pubmed|16707701,21515770]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BP351 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''cat'') available in [SW|Fabian Commichau]'s lab
  • GP2612 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE27320 (''[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab)
  • BKE27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • BKK27320 ([gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
  • Expression vectors

  • C-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP382]: pGP2547, available in [SW|Jörg Stülke]'s lab [pubmed|28189581]
  • lacZ fusion

  • pGP2546 in ([SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GP2537 (kan), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP2527 (in [SW|pBP43]), expression of '' greA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2525 (in [SW|pBP43]), expression of '' greA-FLAG''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 16815708,15720542,15294154,24763425
  • Original Publications

  • 16707701,21266474,21515770,23543716,7854424,17917675,14633991,28242762,28700593,28189581