SubtiBank SubtiBank
malK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

malK

two-component sensor kinase, regulation of malate uptake
locus
BSU_31520
pI
6.95
mw
58.76 kDa
protein length
533 aa Sequence Blast
gene length
1602 bp Sequence Blast
function
regulation of malate uptake
product
two-component sensor kinase
essential
no
synonyms
yufL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,237,157 3,238,758

    Phenotypes of a mutant

  • unable to use malate as the single carbon source [Pubmed|12949159]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain]
  • C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|malK]-[gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A634 (yufL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/634 NBRP B. subtilis, Japan]
  • BKE31520 ([gene|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|malK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACTTCCTTACGT, downstream forward: _UP4_CCGTACGAACCGAAGGAGGA
  • BKK31520 ([gene|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|malK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACTTCCTTACGT, downstream forward: _UP4_CCGTACGAACCGAAGGAGGA
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 10094672,12949160,12949159,12949159,12949160