SubtiBank SubtiBank
czrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

czrA

transcriptional repressor ([SW|ArsR family]), [gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA] and [gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]
locus
BSU_19120
pI
5.72
mw
12.24 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
regulation of resistance against toxic metal cations
product
transcriptional repressor ([SW|ArsR family])
essential
no
synonyms
yozA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    2,084,786 2,085,109

    The protein

    Protein family

  • [SW|ArsR family]
  • Effectors of protein activity

  • DNA-binding activity of CzrA is inactivated by high concentrations of toxic metal ions (induction)
  • Structure

  • [PDB|1R1U] (the apo-repressor from ''Staph. aureus'', 49% identity, 82% similarity) [Pubmed|14568530]
  • [PDB|1R1V] (the Zn(II) form from ''Staph. aureus'', 49% identity, 82% similarity) [Pubmed|14568530]
  • [PDB|2KJB] (the DNA-bound form from ''Staph. aureus'', 49% identity, 82% similarity) [Pubmed|19822742]
  • Expression and Regulation

    Operons

    genes
    [gene|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B412 (yozA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1411 NBRP B. subtilis, Japan]
  • BKE19120 ([gene|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCACCTTTCTTT, downstream forward: _UP4_TGAAAAAGACATCCTTGCTT
  • BKK19120 ([gene|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCACCTTTCTTT, downstream forward: _UP4_TGAAAAAGACATCCTTGCTT
  • References

  • 15948947,16430705,14568530,19822742,25213752,22007899