SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|RNA polymerase ][SW|sporulation]-specific [SW|sigma factor ](SigK) (3' part of the interrupted [gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] gene), with [gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]
16.00 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
late mother cell-specific gene expression
[SW|RNA polymerase ][SW|sporulation]-specific [SW|sigma factor ](SigK) (3' part of the interrupted [gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] gene)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,701,338 2,701,754

    The protein

    Protein family

  • [SW|sigma-70 factor family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,2841290], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|2841290], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|10075739], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [protein|search|SigK], [protein|[GerE]], [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]) [Pubmed|15699190,2841290,10075739,7966271]
  • view in new tab

    view in new tab

    Biological materials


  • BKE26390 ([gene|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCATGAGGATTTCATTAT, downstream forward: _UP4_TAATGCAGAAGAAGCCGGAT
  • BKK26390 ([gene|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCATGAGGATTTCATTAT, downstream forward: _UP4_TAATGCAGAAGAAGCCGGAT
  • References

    The [SW|SigK regulon]

  • 16385044,15383836
  • Other original publications

  • 2163341,3114422,3125151,3121385,23585539,2536191,29180425