SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyridoxal-5-phosphate synthase (glutaminase domain)
21.30 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
pyridoxal-5-phosphate biosynthesis
pyridoxal-5-phosphate synthase (glutaminase domain)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of pyridoxal phosphate]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    19,968 20,558

    Phenotypes of a mutant

  • inactivation of ''[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]'' reduces [SW|sporulation] efficiency to 1.2% that of wild type cells; delayed entry into [SW|sporulation] [Pubmed|26735940]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the hydrolysis of glutamine to glutamate and ammonia as part of the biosynthesis of pyridoxal 5'-phosphate. The resulting ammonia molecule is channeled to the active site of [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|PdxS]. (according to UniProt)
  • aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)
  • Protein family

  • Glutaminase PdxT/SNO family (single member, according to UniProt)
  • Structure

  • [PDB|2NV2] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|PdxS]-[protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|PdxT] complex [Pubmed|17159152]
  • [PDB|2NV0] (PdxT) [Pubmed|17159152]
  • [SW|Localization]

  • cytosol (according to UniProt)
  • Expression and Regulation




  • the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • Additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab


    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • negatively controlled by [SW|Spo0A] [Pubmed|14651647]
  • view in new tab

    view in new tab

    Biological materials


  • BKE00120 ([gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG
  • BKK00120 ([gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG
  • BV604 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|24972371]
  • References

  • 15911615,14762015,14651647,16030023,19152323,17159152,23832367,25473090,25568319,26490441,26735940,16233205,14585832,28189581