SubtiBank SubtiBank
yxeB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeB

hydroxamate siderophore [SW|ABC transporter] (only ferrioxamine) (binding protein)
locus
BSU39610
pI
5.53
mw
35.10 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
siderophore uptake
product
hydroxamate siderophore [SW|ABC transporter]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    4,067,183 4,068,148

    Phenotypes of a mutant

  • no growth with the xenosiderophore ferrioxamine E as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|FhuD]
  • Structure

  • [PDB|4FNA] ([protein|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|FhuD] from Staphylococcus aureus, 35% identity) [pubmed|24606332]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • membrane, lipid modification as retention signal [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|6F4F7A68701FAC3983AF447F11BC1EAB17D7B07B|yxeB]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • repressed unless the cells enter an iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B706 (yxeB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1705 NBRP B. subtilis, Japan]
  • BKE39610 ([gene|6F4F7A68701FAC3983AF447F11BC1EAB17D7B07B|yxeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGAACCCTCCCACTA, downstream forward: _UP4_TAAAAAAACGGCACAGTCAT
  • BKK39610 ([gene|6F4F7A68701FAC3983AF447F11BC1EAB17D7B07B|yxeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGAACCCTCCCACTA, downstream forward: _UP4_TAAAAAAACGGCACAGTCAT
  • References

  • 10092453,16672620,12354229,18957862,18763711,23220087,24606332