SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


flagellar filament assembly protein
18.04 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
flagellar filament assembly
flagellar filament assembly protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,639,787 3,640,269

    Phenotypes of a mutant

  • non-motile cells [Pubmed|24706744]
  • The protein

    Catalyzed reaction/ biological activity

  • essential for flagellar filament assembly, export of hook-filament junction proteins [protein|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|FlgK] and [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|FlgL] [Pubmed|24706744]
  • Modification

  • phosphorylated on Arg-60 [Pubmed|22517742], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • phosphorylation on Tyr-49 [Pubmed|17218307], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    view in new tab

    view in new tab

    Biological materials


  • BKE35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • BKK35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • References

  • 8412657,8045879,17218307,15817382,22517742,24706744,21736639,24728941