SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


flagellar filament assembly protein
18.04 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
flagellar filament assembly
flagellar filament assembly protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,639,787 3,640,269

    Phenotypes of a mutant

  • non-motile cells [Pubmed|24706744]
  • The protein

    Catalyzed reaction/ biological activity

  • essential for flagellar filament assembly, export of hook-filament junction proteins [protein|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|FlgK] and [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|FlgL] [Pubmed|24706744]
  • Modification

  • phosphorylated on Arg-60 [Pubmed|22517742], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • phosphorylation on Tyr-49 [Pubmed|17218307], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    view in new tab

    view in new tab

    Biological materials


  • BKE35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • BKK35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • References

  • 8412657,8045879,17218307,15817382,22517742,24706744,21736639,24728941