SubtiBank SubtiBank
yvyG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvyG

flagellar filament assembly protein
locus
BSU_35420
pI
8.81
mw
18.04 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
flagellar filament assembly
product
flagellar filament assembly protein
essential
no
synonyms
flgN,yviC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    3,639,787 3,640,269

    Phenotypes of a mutant

  • non-motile cells [Pubmed|24706744]
  • The protein

    Catalyzed reaction/ biological activity

  • essential for flagellar filament assembly, export of hook-filament junction proteins [protein|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|FlgK] and [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|FlgL] [Pubmed|24706744]
  • Modification

  • phosphorylated on Arg-60 [Pubmed|22517742], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • phosphorylation on Tyr-49 [Pubmed|17218307], phosphorylation does not affect the properties of the protein [Pubmed|24706744]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    genes
    [gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|21736639]
    view in new tab

    genes
    [gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|8045879]
    view in new tab

    Biological materials

    Mutant

  • BKE35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • BKK35420 ([gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGACATGGGCTTTCTCC, downstream forward: _UP4_GCTTAGCAGAAAGGAATTCA
  • References

  • 8412657,8045879,17218307,15817382,22517742,24706744,21736639,24728941