SubtiBank SubtiBank
pftA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pftA

pyruvate transporter
locus
BSU_28910
pI
9.82
mw
15.57 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
function
uptake of pyruvate
product
pyruvate transporter
essential
no
synonyms
ysbA,lrgA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,955,209 2,955,649

    Phenotypes of a mutant

  • strongly impaired growth with pyruvate as the single carbon source [Pubmed|28974613,27422364]
  • ''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' mutant is delayed in pellicle formation [Pubmed|26060272]
  • a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of pyruvate [pubmed|28974613]
  • Protein family

  • CidA/LrgA family (with [protein|7DA08C189F5524D4874E2F4828264AB2671A5460|YwbH], according to UniProt)
  • [SW|Localization]

  • cell membrane [pubmed|28974613]
  • Expression and Regulation

    Operons

    genes
    [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT]: activation, [Pubmed|28974613,27422364], in [regulon|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([Pubmed|28974613,27422364], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • regulation

  • induced by acetate [Pubmed|26060272]
  • induced by pyruvate ([protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT]) [pubmed|28974613]
  • subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [pubmed|28974613]
  • additional information

  • the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[SW|cshA]'' mutant [Pubmed|23175651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B013 (ysbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1012 NBRP B. subtilis, Japan]
  • GP1554 (''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE28910 ([gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTCACCTCTTTCT, downstream forward: _UP4_TAAGGGAAACAGGAGGTTCT
  • BKK28910 ([gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTCACCTCTTTCT, downstream forward: _UP4_TAAGGGAAACAGGAGGTTCT
  • References

    Reviews

  • 27511628,29208748,29354650
  • Original publications

  • 26060272,23175651,21815947,15659658,17452642,26110430,27422364,28974613