SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


46.27 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,705,398 2,706,615

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials


  • BKE26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • BKK26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • References

  • 18175906