SubtiBank SubtiBank
yrkO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrkO

unknown
locus
BSU26440
pI
10.14
mw
46.27 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,705,398 2,706,615

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]-[gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • BKK26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • References

  • 18175906