SubtiBank SubtiBank
yrkO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrkO

unknown
locus
BSU_26440
pI
10.14
mw
46.27 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,705,398 2,706,615

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]-[gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • BKK26440 ([gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATACTCCTTTCCC, downstream forward: _UP4_TAACCCCCTTGCACAGATTG
  • References

  • 18175906