SubtiBank SubtiBank
tuaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tuaF

biosynthesis of teichuronic acid
locus
BSU_35560
pI
4.55
mw
24.99 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
unknown
essential
no
synonyms
yvhF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,651,879 3,652,559

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35560 ([gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAGTCTCCCTGCTTT, downstream forward: _UP4_TAAAATCATACGATGGAGAT
  • BKK35560 ([gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAGTCTCCCTGCTTT, downstream forward: _UP4_TAAAATCATACGATGGAGAT
  • References

  • 16497325,10048024,9611818,10627039