SubtiBank SubtiBank
yhaH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaH

unknown
locus
BSU_10000
pI
8.60
mw
12.93 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,073,895 1,074,251

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6EF9B43AFDE3AEBE0DA5EDCCEDA99331BA01AE5D|yhaH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A667 (yhaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/667 NBRP B. subtilis, Japan]
  • BKE10000 ([gene|6EF9B43AFDE3AEBE0DA5EDCCEDA99331BA01AE5D|yhaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCCCGTCTT, downstream forward: _UP4_TAATATCCTATTCAAAAGAA
  • BKK10000 ([gene|6EF9B43AFDE3AEBE0DA5EDCCEDA99331BA01AE5D|yhaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATCACCCCGTCTT, downstream forward: _UP4_TAATATCCTATTCAAAAGAA