SubtiBank SubtiBank
epsI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsI

glycosyltransferase, synthesis of extracellular poly-N-acetylglucosamine
locus
BSU_34290
pI
8.04
mw
41.35 kDa
protein length
358 aa Sequence Blast
gene length
1077 bp Sequence Blast
function
synthesis of extracellular poly-N-acetylglucosamine
product
glycosyltransferase
essential
no
synonyms
yveS

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • Gene

    Coordinates
    3,520,030 3,521,106

    The protein

    Protein family

  • polysaccharide pyruvyl transferase family (with [protein|52A47B49B1FB955EE7E3C316B57A2B4134F78480|EpsO] and [protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|YxaB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|YxaB]
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B612 (yveS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1611 NBRP B. subtilis, Japan]
  • BKE34290 ([gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCCTCTGTTT, downstream forward: _UP4_CAATGATCCCGCTCGTCAGC
  • BKK34290 ([gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCCTCTGTTT, downstream forward: _UP4_CAATGATCCCGCTCGTCAGC
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605