SubtiBank SubtiBank
yqxI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxI

unknown secreted protein
locus
BSU25890
pI
5.44
mw
16.87 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdE

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,663,929 2,664,408

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Additional information

  • folding of YqxI to an active conformation requires chaperone activity of [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] [Pubmed|23937099]
  • Expression and Regulation

    Operons

    genes
    [gene|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI]-[gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE25890 ([gene|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCAATCCCTTTCT, downstream forward: _UP4_TAATTGAGGTGATTTGAATT
  • BKK25890 ([gene|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCAATCCCTTTCT, downstream forward: _UP4_TAATTGAGGTGATTTGAATT
  • References

  • 14651647,18957862,12850135,20817675,23937099