SubtiBank SubtiBank
ampS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ampS

aminopeptidase
locus
BSU_14450
pI
4.95
mw
45.64 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
function
required for biofilm formation
product
aminopeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    1,514,997 1,516,229

    The protein

    Protein family

  • peptidase M29 family (single member, according to UniProt)
  • Structure

  • [PDB|4ICQ] (from Streptococcus pneumoniae, 52% identity) [pubmed|23999297]
  • Expression and Regulation

    Operons

    genes
    [gene|6E6D17F51F9A82D38EA985AA7E09CB9530583802|ampS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14450 ([gene|6E6D17F51F9A82D38EA985AA7E09CB9530583802|ampS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCAAGC, downstream forward: _UP4_TAAGTAAATAAAAGGAGGCT
  • BKK14450 ([gene|6E6D17F51F9A82D38EA985AA7E09CB9530583802|ampS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCAAGC, downstream forward: _UP4_TAAGTAAATAAAAGGAGGCT
  • References

  • 8969500,16088219,23999297