SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


45.64 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
required for biofilm formation

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    1,514,997 1,516,229

    The protein

    Protein family

  • peptidase M29 family (single member, according to UniProt)
  • Structure

  • [PDB|4ICQ] (from Streptococcus pneumoniae, 52% identity) [pubmed|23999297]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14450 ([gene|6E6D17F51F9A82D38EA985AA7E09CB9530583802|ampS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCAAGC, downstream forward: _UP4_TAAGTAAATAAAAGGAGGCT
  • BKK14450 ([gene|6E6D17F51F9A82D38EA985AA7E09CB9530583802|ampS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCAAGC, downstream forward: _UP4_TAAGTAAATAAAAGGAGGCT
  • References

  • 8969500,16088219,23999297