SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


65.91 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast
starch and maltodextrin utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of starch/ maltodextrin]
  • Gene

    3,547,550 3,549,235

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (16)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to Swiss-Prot)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A641BA91317CBCFE34A2BE69007247F209075095|YcdG], [protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|YugT], [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|TreA]
  • Structure

  • [PDB|1UOK] (from ''Bacillus cereus'', 57% identity, 74% similarity) [Pubmed|9193006]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation




  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials


  • BKE34560 ([gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAAACGACAGCTTCTTTCC, downstream forward: _UP4_GAAGCTGTGATGGGCATTAG
  • BKK34560 ([gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAAACGACAGCTTCTTTCC, downstream forward: _UP4_GAAGCTGTGATGGGCATTAG
  • References

  • 9573215,10229946,16707683