SubtiBank SubtiBank
tuaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tuaG

sugar transferase
locus
BSU35550
pI
7.14
mw
29.19 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
sugar transferase
essential
no
synonyms
yvhG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,651,097 3,651,855

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to Swiss-Prot)
  • Structure

  • [PDB|5TZE] (from Staphylococcus aureus, corresponds to aa 9 ... 141, 37% identity) [pubmed|27973583]
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35550 ([gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCACATCTCCATCGT, downstream forward: _UP4_TAGCTGCAAACAGAGAGAAA
  • BKK35550 ([gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCACATCTCCATCGT, downstream forward: _UP4_TAGCTGCAAACAGAGAGAAA
  • References

  • 16497325,10048024,9611818,10627039,27973583