SubtiBank SubtiBank
yttA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yttA

unknown
locus
BSU_30360
pI
7.75
mw
27.53 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,108,614 3,109,360

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6E200AAFBFAD3B86BED40A86A382EE0EAEF1090E|yttA]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced by good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A134 (yttA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/134 NBRP B. subtilis, Japan]
  • BKE30360 ([gene|6E200AAFBFAD3B86BED40A86A382EE0EAEF1090E|yttA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATGACCCCTTTTTC, downstream forward: _UP4_TAAACAAAAAGCTCCAGAAT
  • BKK30360 ([gene|6E200AAFBFAD3B86BED40A86A382EE0EAEF1090E|yttA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATGACCCCTTTTTC, downstream forward: _UP4_TAAACAAAAAGCTCCAGAAT
  • References

  • 12823818,25755103,16479537