SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small acid-soluble spore protein (minor), SASP
7.72 kDa
protein length
gene length
216 bp Sequence Blast
protection of spore DNA
small acid-soluble spore protein (minor), SASP

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Small acid-soluble spore proteins]
  • Gene

    2,931,692 2,931,907

    The protein

    Protein family

  • sspI family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,10806362], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325,10806362]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-B025 (ysfA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28660 ([gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACGCTCCTTTTT, downstream forward: _UP4_TAAGACATGAAACCGGGTGA
  • BKK28660 ([gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACGCTCCTTTTT, downstream forward: _UP4_TAAGACATGAAACCGGGTGA
  • References

  • 10806362,16497325,30782632