SubtiBank SubtiBank
xkdJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

xkdJ

PBSX prophage
locus
BSU_12640
pI
4.87
mw
16.60 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,331,743 1,332,183

    Expression and Regulation

    Operons

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849,2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE12640 ([gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCTCCTCCTTTACA, downstream forward: _UP4_ATGAACAGCGGGGTGAAATA
  • BKK12640 ([gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCTCCTCCTTTACA, downstream forward: _UP4_ATGAACAGCGGGGTGAAATA
  • References

  • 2110147,8083174,27766092