SubtiBank SubtiBank
pyrR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrR

transcriptional antiterminator of the pyr operon
locus
BSU15470
pI
4.99
mw
20.12 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
regulation of pyrimidine biosynthesis
product
transcriptional antiterminator with minor uracil phosphoribosyltransferase activity
essential
no
ec
2.4.2.9
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    1,618,304 1,618,849

    The protein

    Catalyzed reaction/ biological activity

  • UMP + diphosphate = uracil + 5-phospho-alpha-D-ribose 1-diphosphate (according to Swiss-Prot)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Effectors of protein activity

  • UMP and UTP stimulate the RNA-binding activity of PyrR, resulting of transcription termination of the [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE] operon [pubmed|31100987]
  • Structure

  • [PDB|1A3C] (dimeric form)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000061 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]-[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]-[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE15470 ([gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTGACACCTCACAG, downstream forward: _UP4_GCCATTTATGAAAACGAATA
  • BKK15470 ([gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTGACACCTCACAG, downstream forward: _UP4_GCCATTTATGAAAACGAATA
  • References

    Reviews

  • 28031352,31100987
  • Original publications

  • 8935652,8206849,15716449,11726695,9488732,9551555,12896995,9932459,8955403,8824632,12482852,1709162,7798145,11948166,8759868,7868607,9488732,17322189