SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


28.06 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,080,351 2,081,094

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 102-247) (according to UniProt)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A314 (yobR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19060 ([gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATAATGCCTCTCCC, downstream forward: _UP4_AAAAGATGACCAAAGGAAGG
  • BKK19060 ([gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATAATGCCTCTCCC, downstream forward: _UP4_AAAAGATGACCAAAGGAAGG