SubtiBank SubtiBank
yobR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobR

unknown
locus
BSU_19060
pI
7.69
mw
28.06 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,080,351 2,081,094

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 102-247) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]-[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]-[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A314 (yobR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/314 NBRP B. subtilis, Japan]
  • BKE19060 ([gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATAATGCCTCTCCC, downstream forward: _UP4_AAAAGATGACCAAAGGAAGG
  • BKK19060 ([gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATAATGCCTCTCCC, downstream forward: _UP4_AAAAGATGACCAAAGGAAGG