SubtiBank SubtiBank
yxeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeA

unknown
locus
BSU_39620
pI
8.10
mw
12.88 kDa
protein length
115 aa Sequence Blast
gene length
348 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,068,189 4,068,536

    The protein

    Structure

  • [PDB|3NPP]
  • Expression and Regulation

    Operons

    genes
    [gene|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]-[gene|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|yxdM]-[gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]
    description
    [Pubmed|15289557]

    regulatory mechanism

  • [protein|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ]: activation, [Pubmed|15289557], in [regulon|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ regulon]
  • regulation

  • induced by a cationic antimicrobial peptide, LL-37 ([protein|search|YxdJ]) [Pubmed| 21078927]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B775 (yxeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1774 NBRP B. subtilis, Japan]
  • BKE39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC, downstream forward: _UP4_TGAATCATAAAAAACGGCAC
  • BKK39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC, downstream forward: _UP4_TGAATCATAAAAAACGGCAC
  • References

  • 15289557,21078927