SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.88 kDa
protein length
115 aa Sequence Blast
gene length
348 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,068,189 4,068,536

    The protein


  • [PDB|3NPP]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ]: activation, [Pubmed|15289557], in [regulon|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ regulon]
  • regulation

  • induced by a cationic antimicrobial peptide, LL-37 ([protein|search|YxdJ]) [Pubmed| 21078927]
  • view in new tab

    Biological materials


  • MGNA-B775 (yxeA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC, downstream forward: _UP4_TGAATCATAAAAAACGGCAC
  • BKK39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC, downstream forward: _UP4_TGAATCATAAAAAACGGCAC
  • References

  • 15289557,21078927