SubtiBank SubtiBank
czcO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

czcO

similar to flavin-containing monooxygenase, facilitates cation export via [protein|7FB5BCC16D688465A820F436F657C49625257884|CzcD]
locus
BSU_26640
pI
9.83
mw
38.91 kDa
protein length
345 aa Sequence Blast
gene length
1038 bp Sequence Blast
function
resistance to toxic metal ions
product
unknown
essential
no
synonyms
trkA,yrdP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.4|Trace metals/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    2,722,767 2,723,804

    The protein

    Structure

  • [PDB|4USQ] (from Cellvibrio sp., 23% identity) [pubmed|25383040]
  • Expression and Regulation

    Operons

    genes
    [gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]-[gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]
    description
    [Pubmed|15948947]

    regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced in the presence of toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • BKE26640 ([gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTATCACCCCGCCAAT, downstream forward: _UP4_TAAACGAAGCAGAGCAGTAA
  • BKK26640 ([gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTATCACCCCGCCAAT, downstream forward: _UP4_TAAACGAAGCAGAGCAGTAA
  • References

  • 15948947,12100555,25383040