SubtiBank SubtiBank
yrhH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrhH

similar to methyltransferase
locus
BSU_27180
pI
10.16
mw
20.99 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,777,877 2,778,419

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]
    description
    [Pubmed|9683469]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9683469], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    genes
    [gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]-[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
    description
    [Pubmed|18179421]

    regulation

  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • BKE27180 ([gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAACACCTGCTTTT, downstream forward: _UP4_TAAAAAATTTCTCGGGAAAT
  • BKK27180 ([gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAACACCTGCTTTT, downstream forward: _UP4_TAAAAAATTTCTCGGGAAAT
  • References

  • 21926231,9683469,18179421,21815947