SubtiBank SubtiBank
ppiB [2019-09-18 10:09:00]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

ppiB [2019-09-18 10:09:00]

peptidyl-prolyl isomerase
15.11 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
protein folding
peptidyl-prolyl isomerase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • Gene

    2,435,360 2,435,791

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-peptidylproline (ω=180) --> [protein]-peptidylproline (ω=0) (according to UniProt)
  • Protein family

  • cyclophilin-type PPIase family (single member, according to UniProt)
  • Structure

  • [PDB|2MVZ] (from Geobacillus kaustophilus, 75% identity) [pubmed|25923019]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8022278], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE23360 ([gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT, downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
  • BKK23360 ([gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT, downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
  • References

  • 9748346,1516692,9297832,8639516,8022278,25923019