SubtiBank SubtiBank
ppiB [2018-12-07 17:08:02]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ppiB [2018-12-07 17:08:02]

peptidyl-prolyl isomerase
locus
BSU23360
pI
5.47
mw
15.11 kDa
protein length
143 aa Sequence Blast
gene length
429 bp Sequence Blast
function
protein folding
product
peptidyl-prolyl isomerase
essential
no
ec
5.2.1.8
synonyms
cypBS

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • Gene

    Coordinates
    2,435,360 → 2,435,791

    The protein

    Catalyzed reaction/ biological activity

  • Peptidylproline (omega=180) = peptidylproline (omega=0) (according to Swiss-Prot)
  • Protein family

  • cyclophilin-type PPIase family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]
    description
    [Pubmed|8022278]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8022278], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE23360 (Δ[gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT, downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
  • BKK23360 (Δ[gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT, downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
  • References

  • 9748346,1516692,9297832,8639516,8022278